ZFIN ID: ZDB-MRPHLNO-081218-2
Morpholino Name: MO4-crb2a
Target: crb2a (1)
Previous Name: MO4-crb2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACAGTTTACACCTACAGAGATCACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino targeting the splice acceptor sequence in the intron between exons two and three.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-crb2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-crb2a No data available
PHENOTYPE
Phenotype resulting from MO4-crb2a
No data available

Phenotype of all Fish created by or utilizing MO4-crb2a
Genome Resources:
CITATIONS (2)