ZFIN ID: ZDB-MRPHLNO-081218-2
Morpholino Name: MO4-crb2a
Target: crb2a (1)
Previous Name: MO4-crb2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACAGTTTACACCTACAGAGATCACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino targeting the splice acceptor sequence in the intron between exons two and three.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-crb2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-crb2a No data available
PHENOTYPE
Phenotype resulting from MO4-crb2a
No data available

Phenotype of all Fish created by or utilizing MO4-crb2a
Phenotype Fish Conditions Figures
retinal ganglion cell increased distribution, abnormal AB + MO3-crb2a + MO4-crb2a standard conditions Fig. S1 with image from Hsu et al., 2006
retinal rod cell increased distribution, abnormal AB + MO3-crb2a + MO4-crb2a standard conditions Fig. S1 with image from Hsu et al., 2006
retinal pigmented epithelium patchy, abnormal AB + MO3-crb2a + MO4-crb2a standard conditions Fig. S1 with image from Hsu et al., 2006
retinal outer nuclear layer distributed, abnormal AB + MO3-crb2a + MO4-crb2a standard conditions Fig. S1 with image from Hsu et al., 2006
retinal rod cell disorganized, abnormal AB + MO3-crb2a + MO4-crb2a standard conditions Fig. S1 with image from Hsu et al., 2006
retinal ganglion cell disorganized, abnormal AB + MO3-crb2a + MO4-crb2a standard conditions Fig. S1 with image from Hsu et al., 2006
retinal inner nuclear layer distributed, abnormal AB + MO3-crb2a + MO4-crb2a standard conditions Fig. S1 with image from Hsu et al., 2006
OTHER MO4-crb2a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)