ZFIN ID: ZDB-MRPHLNO-081110-2
Morpholino Name: MO2-lclat1
Target: lclat1 (1)
Previous Names: lycat-MO2 (1), MO2-lycat (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAAGCTCTGCGTACCACAGGTAAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lclat1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lclat1
Expressed Gene Anatomy Figures
fli1 Fig. 1 from Xiong et al., 2008
PHENOTYPE
Phenotype resulting from MO2-lclat1
No data available

Phenotype of all Fish created by or utilizing MO2-lclat1
No data available
Genome Resources:
CITATIONS (2)