header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081029-9
Morpholino Name: MO1-mmp9
Target: mmp9 (1)
Sequence:
5' - GAGTCGCAAATATAAAAGTAAATTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mmp9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mmp9 No data available
PHENOTYPE
Phenotype resulting from MO1-mmp9
Phenotype of all Fish created by or utilizing MO1-mmp9
OTHER MO1-mmp9 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)