Morpholino

MO1-dnaaf11

ID

ZDB-MRPHLNO-080929-4

Name

MO1-dnaaf11

Previous Names

MO1-lrrc6
sea-MO (1)

Target

dnaaf11 (1)

Sequence

5' - GCGGACCATGACTTGCTGGTCTAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dnaaf11

Expressed Gene	Anatomy	Figures
chrd	margin shield	Fig. 3 from Kishimoto et al., 2008
dnaaf11	(not) pronephric duct whole organism	Fig. 2 , Fig. S2 , Fig. S4 from Kishimoto et al., 2008
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 3 from Kishimoto et al., 2008
gsc	margin presumptive shield shield	Fig. 3 from Kishimoto et al., 2008
myod1	somite	Fig. 3 from Kishimoto et al., 2008
shha	notochord	Fig. 1 from Kishimoto et al., 2008
spaw	lateral plate mesoderm	Fig. 1 from Kishimoto et al., 2008
tbxta	notochord	Fig. 1 from Kishimoto et al., 2008
vent	margin	Fig. 3 from Kishimoto et al., 2008

Phenotype

Phenotype resulting from MO1-dnaaf11

Phenotype	Fish	Figures
convergent extension involved in gastrulation disrupted, abnormal	AB/TU + MO1-dnaaf11	Fig. 3 from Kishimoto et al., 2008
determination of left/right symmetry disrupted, abnormal	AB/TU + MO1-dnaaf11	Fig. 1 from Kishimoto et al., 2008
optic vesicle decreased size, abnormal	AB/TU + MO1-dnaaf11	Fig. 3 from Kishimoto et al., 2008
paraxial mesoderm increased width, abnormal	AB/TU + MO1-dnaaf11	Fig. 3 from Kishimoto et al., 2008
paraxial mesoderm mesodermal cell disoriented, abnormal	AB/TU + MO1-dnaaf11	Fig. 3 from Kishimoto et al., 2008
pronephric duct morphology, abnormal	AB/TU + MO1-dnaaf11	Fig. 2 , Fig. S2 from Kishimoto et al., 2008
pronephros cystic, abnormal	AB/TU + MO1-dnaaf11	Fig. 1 from Kishimoto et al., 2008
tail bud increased length, abnormal	AB/TU + MO1-dnaaf11	Fig. 3 from Kishimoto et al., 2008
tail bud protruding, abnormal	AB/TU + MO1-dnaaf11	Fig. 3 from Kishimoto et al., 2008
whole organism curved ventral, abnormal	AB/TU + MO1-dnaaf11	Fig. 1 , Fig. 3 from Kishimoto et al., 2008
whole organism wholly dorsalized, abnormal	AB/TU + MO1-dnaaf11	Fig. 3 from Kishimoto et al., 2008

Phenotype of all Fish created by or utilizing MO1-dnaaf11

Phenotype	Fish	Conditions	Figures
convergent extension involved in gastrulation disrupted, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 3 from Kishimoto et al., 2008
optic vesicle decreased size, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 3 from Kishimoto et al., 2008
paraxial mesoderm increased width, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 3 from Kishimoto et al., 2008
pronephros cystic, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 1 from Kishimoto et al., 2008
pronephric duct morphology, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 2 , Fig. S2 from Kishimoto et al., 2008
tail bud protruding, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 3 from Kishimoto et al., 2008
paraxial mesoderm mesodermal cell disoriented, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 3 from Kishimoto et al., 2008
whole organism curved ventral, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 1 , Fig. 3 from Kishimoto et al., 2008
determination of left/right symmetry disrupted, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 1 from Kishimoto et al., 2008
tail bud increased length, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 3 from Kishimoto et al., 2008
whole organism wholly dorsalized, abnormal	AB/TU + MO1-dnaaf11	standard conditions	Fig. 3 from Kishimoto et al., 2008
whole organism curved ventral, abnormal	AB/TU + MO1-dnaaf11 + MO1-prickle1a	standard conditions	Fig. 3 from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal	AB/TU + MO1-dnaaf11 + MO1-prickle1a	standard conditions	Fig. 3 from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal	AB/TU + MO1-dnaaf11 + MO1-prickle1a	standard conditions	Fig. 3 from Kishimoto et al., 2008
whole organism decreased length, abnormal	AB/TU + MO1-dnaaf11 + MO1-prickle1a	standard conditions	Fig. 3 from Kishimoto et al., 2008
somite increased width, abnormal	AB/TU + MO1-dnaaf11 + MO1-prickle1a	standard conditions	Fig. 3 from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal	AB/TU + MO1-dnaaf11 + MO1-prickle1a	standard conditions	Fig. 3 from Kishimoto et al., 2008
whole organism decreased length, abnormal	AB/TU + MO1-dnaaf11 + MO2-invs	standard conditions	Fig. 3 from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal	AB/TU + MO1-dnaaf11 + MO2-invs	standard conditions	Fig. 3 from Kishimoto et al., 2008
somite increased width, abnormal	AB/TU + MO1-dnaaf11 + MO2-invs	standard conditions	Fig. 3 from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal	AB/TU + MO1-dnaaf11 + MO2-invs	standard conditions	Fig. 3 from Kishimoto et al., 2008
whole organism curved ventral, abnormal	AB/TU + MO1-dnaaf11 + MO2-invs	standard conditions	Fig. 3 from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal	AB/TU + MO1-dnaaf11 + MO2-invs	standard conditions	Fig. 3 from Kishimoto et al., 2008
trunk curved ventral, abnormal	WT + MO1-dnaaf11 + MO1-ruvbl2	standard conditions	Fig. S4 from Zhao et al., 2013
post-vent region curved ventral, abnormal	WT + MO1-dnaaf11 + MO1-ruvbl2	standard conditions	Fig. S4 from Zhao et al., 2013
pronephros cystic, abnormal	WT + MO1-dnaaf11 + MO1-ruvbl2	standard conditions	Fig. S4 from Zhao et al., 2013

Citations