Morpholino

MO1-fkrp

ID
ZDB-MRPHLNO-080918-1
Name
MO1-fkrp
Previous Names
  • FKRPMO (1)
Target
Sequence
5' - ACTGATACGCATTATGGCTCTTGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fkrp
Expressed Gene Anatomy Figures
dag1 Fig. 6 from Thornhill et al., 2008
Phenotype
Phenotype resulting from MO1-fkrp
Phenotype Fish Figures
brain morphology, abnormal AB + MO1-fkrp Fig. 2,  Fig. 3 from Thornhill et al., 2008
dorsal aorta intersegmental vessel separated from dorsal longitudinal anastomotic vessel, abnormal y1Tg + MO1-fkrp Fig. 5 from Wood et al., 2011
embryo development delayed, abnormal y1Tg + MO1-fkrp Fig. 2 from Wood et al., 2011
eye decreased diameter, abnormal AB + MO1-fkrp Fig. 1,  Fig. 2,  Fig. 3,  Fig. 4 from Thornhill et al., 2008
eye morphology, abnormal AB + MO1-fkrp Fig. 1 from Thornhill et al., 2008
horizontal myoseptum aplastic, abnormal AB + MO1-fkrp Fig. 4,  Fig. 5 from Thornhill et al., 2008
inner optic circle blood vessel decreased size, abnormal y1Tg + MO1-fkrp Fig. 6 from Wood et al., 2011
inner optic circle blood vessel elliptic, abnormal y1Tg + MO1-fkrp Fig. 6 from Wood et al., 2011
larval locomotory behavior disrupted, abnormal y1Tg + MO1-fkrp Fig. 2 from Wood et al., 2011
midbrain hindbrain boundary morphology, abnormal AB + MO1-fkrp Fig. 1 from Thornhill et al., 2008
myotome decreased mass, abnormal AB + MO1-fkrp Fig. 2,  Fig. 3 from Thornhill et al., 2008
myotome basement membrane morphology, abnormal AB + MO1-fkrp Fig. 5 from Thornhill et al., 2008
neural tube disorganized, abnormal AB + MO1-fkrp Fig. 4 from Thornhill et al., 2008
notochord disorganized, abnormal AB + MO1-fkrp Fig. 4 from Thornhill et al., 2008
ocular blood vessel decreased size, abnormal y1Tg + MO1-fkrp Fig. 7 from Wood et al., 2011
ocular blood vessel deformed, abnormal y1Tg + MO1-fkrp Fig. 6 from Wood et al., 2011
post-vent region bent, abnormal AB + MO1-fkrp Fig. 1,  Fig. 2,  Fig. 3 from Thornhill et al., 2008
post-vent region curved ventral, abnormal AB + MO1-fkrp Fig. 1,  Fig. 2,  Fig. 3 from Thornhill et al., 2008
post-vent region decreased length, abnormal y1Tg + MO1-fkrp Fig. 2 from Wood et al., 2011
post-vent region movement quality, abnormal AB + MO1-fkrp Fig. 2,  Fig. 3 from Thornhill et al., 2008
protein glycosylation disrupted, abnormal AB + MO1-fkrp Fig. 7 from Thornhill et al., 2008
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-fkrp Fig. 4 from Thornhill et al., 2008
retinal neural layer disorganized, abnormal AB + MO1-fkrp Fig. 4 from Thornhill et al., 2008
somite morphology, abnormal AB + MO1-fkrp Fig. 6 from Thornhill et al., 2008
somite intersegmental vessel absent, abnormal y1Tg + MO1-fkrp Fig. 5 from Wood et al., 2011
somite intersegmental vessel disorganized, abnormal y1Tg + MO1-fkrp Fig. 5 from Wood et al., 2011
somite myofibril unstructured, abnormal y1Tg + MO1-fkrp Fig. 3 from Wood et al., 2011
somite myoseptum deformed, abnormal y1Tg + MO1-fkrp Fig. 4 from Wood et al., 2011
somite border U-shaped, abnormal AB + MO1-fkrp Fig. 1,  Fig. 2,  Fig. 3,  Fig. 5,  Fig. 6 from Thornhill et al., 2008
trunk contractile muscle fiber disorganized, abnormal AB + MO1-fkrp Fig. 4,  Fig. 5 from Thornhill et al., 2008
vertical myoseptum morphology, abnormal AB + MO1-fkrp Fig. 5 from Thornhill et al., 2008
whole organism dead, abnormal y1Tg + MO1-fkrp Fig. 2 from Wood et al., 2011
whole organism lethal (sensu genetics), abnormal AB + MO1-fkrp Fig. 1 from Thornhill et al., 2008
whole organism mobility, abnormal AB + MO1-fkrp Fig. 2,  Fig. 3 from Thornhill et al., 2008
Phenotype of all Fish created by or utilizing MO1-fkrp
Phenotype Fish Conditions Figures
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-fkrp standard conditions Fig. 4 from Thornhill et al., 2008
eye morphology, abnormal AB + MO1-fkrp standard conditions Fig. 1 from Thornhill et al., 2008
retinal neural layer disorganized, abnormal AB + MO1-fkrp standard conditions Fig. 4 from Thornhill et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO1-fkrp standard conditions Fig. 1 from Thornhill et al., 2008
notochord disorganized, abnormal AB + MO1-fkrp standard conditions Fig. 4 from Thornhill et al., 2008
protein glycosylation disrupted, abnormal AB + MO1-fkrp standard conditions Fig. 7 from Thornhill et al., 2008
post-vent region curved ventral, abnormal AB + MO1-fkrp standard conditions Fig. 1,  Fig. 2,  Fig. 3 from Thornhill et al., 2008
myotome decreased mass, abnormal AB + MO1-fkrp standard conditions Fig. 2,  Fig. 3 from Thornhill et al., 2008
brain morphology, abnormal AB + MO1-fkrp standard conditions Fig. 2,  Fig. 3 from Thornhill et al., 2008
myotome basement membrane morphology, abnormal AB + MO1-fkrp standard conditions Fig. 5 from Thornhill et al., 2008
whole organism mobility, abnormal AB + MO1-fkrp standard conditions Fig. 2,  Fig. 3 from Thornhill et al., 2008
post-vent region bent, abnormal AB + MO1-fkrp standard conditions Fig. 1,  Fig. 2,  Fig. 3 from Thornhill et al., 2008
midbrain hindbrain boundary morphology, abnormal AB + MO1-fkrp standard conditions Fig. 1 from Thornhill et al., 2008
trunk contractile muscle fiber disorganized, abnormal AB + MO1-fkrp standard conditions Fig. 4,  Fig. 5 from Thornhill et al., 2008
eye decreased diameter, abnormal AB + MO1-fkrp standard conditions Fig. 1,  Fig. 2,  Fig. 3,  Fig. 4 from Thornhill et al., 2008
post-vent region movement quality, abnormal AB + MO1-fkrp standard conditions Fig. 2,  Fig. 3 from Thornhill et al., 2008
somite border U-shaped, abnormal AB + MO1-fkrp standard conditions Fig. 1,  Fig. 2,  Fig. 3,  Fig. 5,  Fig. 6 from Thornhill et al., 2008
somite morphology, abnormal AB + MO1-fkrp standard conditions Fig. 6 from Thornhill et al., 2008
neural tube disorganized, abnormal AB + MO1-fkrp standard conditions Fig. 4 from Thornhill et al., 2008
vertical myoseptum morphology, abnormal AB + MO1-fkrp standard conditions Fig. 5 from Thornhill et al., 2008
horizontal myoseptum aplastic, abnormal AB + MO1-fkrp standard conditions Fig. 4,  Fig. 5 from Thornhill et al., 2008
dorsal aorta intersegmental vessel separated from dorsal longitudinal anastomotic vessel, abnormal y1Tg + MO1-fkrp standard conditions Fig. 5 from Wood et al., 2011
somite myofibril unstructured, abnormal y1Tg + MO1-fkrp standard conditions Fig. 3 from Wood et al., 2011
inner optic circle blood vessel decreased size, abnormal y1Tg + MO1-fkrp standard conditions Fig. 6 from Wood et al., 2011
somite intersegmental vessel absent, abnormal y1Tg + MO1-fkrp standard conditions Fig. 5 from Wood et al., 2011
inner optic circle blood vessel elliptic, abnormal y1Tg + MO1-fkrp standard conditions Fig. 6 from Wood et al., 2011
somite intersegmental vessel disorganized, abnormal y1Tg + MO1-fkrp standard conditions Fig. 5 from Wood et al., 2011
somite myoseptum deformed, abnormal y1Tg + MO1-fkrp standard conditions Fig. 4 from Wood et al., 2011
embryo development delayed, abnormal y1Tg + MO1-fkrp standard conditions Fig. 2 from Wood et al., 2011
ocular blood vessel deformed, abnormal y1Tg + MO1-fkrp standard conditions Fig. 6 from Wood et al., 2011
post-vent region decreased length, abnormal y1Tg + MO1-fkrp standard conditions Fig. 2 from Wood et al., 2011
larval locomotory behavior disrupted, abnormal y1Tg + MO1-fkrp standard conditions Fig. 2 from Wood et al., 2011
ocular blood vessel decreased size, abnormal y1Tg + MO1-fkrp standard conditions Fig. 7 from Wood et al., 2011
whole organism dead, abnormal y1Tg + MO1-fkrp standard conditions Fig. 2 from Wood et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.