Morpholino

MO1-sox18

ID
ZDB-MRPHLNO-080725-1
Name
MO1-sox18
Previous Names
  • MOsox18-ATG (1)
Target
Sequence
5' - ATATTCATTCCAGCAAGACCAACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sox18
Phenotype
Phenotype resulting from MO1-sox18
Phenotype of all Fish created by or utilizing MO1-sox18
Phenotype Fish Conditions Figures
artery blood vessel endothelium EGFP expression decreased amount, abnormal zf2188Tg + MO1-sox18 standard conditions Fig. 7 with image from Chiang et al., 2017
dorsal aorta EGFP expression decreased amount, abnormal zf2188Tg + MO1-sox18 standard conditions Fig. 7 with image from Chiang et al., 2017
intersegmental vessel EGFP expression decreased amount, abnormal zf2188Tg + MO1-sox18 standard conditions Fig. 7 with image from Chiang et al., 2017
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: 2-(2-amino-3-methoxyphenyl)chromen-4-one Fig. 6 from Duong et al., 2014
dorsal aorta blood vessel endothelium EGFP expression decreased amount, abnormal s843Tg; um13Tg + MO1-sox18 standard conditions Fig. 5 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: 2-(2-amino-3-methoxyphenyl)chromen-4-one Fig. 6 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: semaxanib Fig. 6 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: U0126 Fig. 6 from Duong et al., 2014
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: semaxanib Fig. 6 from Duong et al., 2014
posterior cardinal vein blood vessel endothelium EGFP expression decreased amount, abnormal s843Tg; um13Tg + MO1-sox18 standard conditions Fig. 5 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: semaxanib Fig. 6 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: U0126 Fig. 6 from Duong et al., 2014
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: U0126 Fig. 6 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: 2-(2-amino-3-methoxyphenyl)chromen-4-one Fig. 6 from Duong et al., 2014
blood vessel morphogenesis disrupted, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 2Fig. S4Fig. S5 from Herpers et al., 2008
dorsal aorta notch1b expression decreased amount, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 9 with image from Chiang et al., 2017
dorsal aorta morphology, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. S5 from Herpers et al., 2008
intersegmental vessel notch1b expression decreased amount, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 9 with image from Chiang et al., 2017
posterior cardinal vein morphology, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. S5 from Herpers et al., 2008
blood circulation disrupted, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 1Fig. S1 from Herpers et al., 2008
cell fate specification disrupted, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 2Fig. S4 from Herpers et al., 2008
pericardium edematous, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. S5 with image from Chiang et al., 2017
text only from Herpers et al., 2008
dorsal aorta fused with posterior cardinal vein, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. S5 with image from Chiang et al., 2017
whole organism EGFP expression decreased amount, abnormal s843Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
whole organism kdrl expression decreased amount, abnormal s843Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
blood circulation disrupted, abnormal s843Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 1 from Herpers et al., 2008
whole organism EGFP expression decreased amount, abnormal s843Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 5 from Duong et al., 2014
posterior cardinal vein morphology, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3Fig. S1 from Herpers et al., 2008
cell fate specification disrupted, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3 from Herpers et al., 2008
dorsal aorta morphology, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3Fig. S1 from Herpers et al., 2008
blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3Fig. S1 from Herpers et al., 2008
artery blood vessel endothelium EGFP expression decreased amount, abnormal zf2188Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 7 with image from Chiang et al., 2017
dorsal aorta EGFP expression decreased amount, abnormal zf2188Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 7 with image from Chiang et al., 2017
intersegmental vessel EGFP expression decreased amount, abnormal zf2188Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 7 with image from Chiang et al., 2017
posterior cardinal vein endothelial cell increased amount, abnormal nim5Tg; uq2bhTg + MO1-sox18 + MO1-sox7 standard conditions Fig. 7 from Koltowska et al., 2015
dorsal aorta blood vessel endothelium EGFP expression absent, abnormal s843Tg; um13Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
posterior cardinal vein blood vessel endothelium EGFP expression absent, abnormal s843Tg; um13Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
blood vessel endothelium EGFP expression decreased amount, abnormal s843Tg; um13Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 1 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 1 from Duong et al., 2014
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 1 from Duong et al., 2014
Citations