header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080725-1
Morpholino Name: MO1-sox18
Target: sox18 (1)
Previous Name: MOsox18-ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATATTCATTCCAGCAAGACCAACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sox18 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sox18
Expressed Gene Anatomy Figures
efnb2a Fig. S6 from Herpers et al., 2008
flt4 Fig. S6 from Herpers et al., 2008
mafba Fig. 7 from Koltowska et al., 2015
PHENOTYPE
Phenotype resulting from MO1-sox18
Phenotype of all Fish created by or utilizing MO1-sox18
Phenotype Fish Conditions Figures
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: 2-(2-amino-3-methoxyphenyl)chromen-4-one Fig. 6 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: 2-(2-amino-3-methoxyphenyl)chromen-4-one Fig. 6 from Duong et al., 2014
dorsal aorta blood vessel endothelium EGFP expression decreased amount, abnormal s843Tg; um13Tg + MO1-sox18 standard conditions Fig. 5 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: semaxanib Fig. 6 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: U0126 Fig. 6 from Duong et al., 2014
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: semaxanib Fig. 6 from Duong et al., 2014
posterior cardinal vein blood vessel endothelium EGFP expression decreased amount, abnormal s843Tg; um13Tg + MO1-sox18 standard conditions Fig. 5 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: U0126 Fig. 6 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: semaxanib Fig. 6 from Duong et al., 2014
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: U0126 Fig. 6 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 chemical treatment by environment: 2-(2-amino-3-methoxyphenyl)chromen-4-one Fig. 6 from Duong et al., 2014
blood vessel morphogenesis disrupted, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 2Fig. S4Fig. S5 from Herpers et al., 2008
dorsal aorta morphology, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. S5 from Herpers et al., 2008
posterior cardinal vein morphology, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. S5 from Herpers et al., 2008
blood circulation disrupted, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 1Fig. S1 from Herpers et al., 2008
cell fate specification disrupted, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions Fig. 2Fig. S4 from Herpers et al., 2008
pericardium edematous, abnormal WT + MO1-sox18 + MO1-sox7 standard conditions text only from Herpers et al., 2008
whole organism EGFP expression decreased amount, abnormal s843Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
whole organism kdrl expression decreased amount, abnormal s843Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
blood circulation disrupted, abnormal s843Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 1 from Herpers et al., 2008
whole organism EGFP expression decreased amount, abnormal s843Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 5 from Duong et al., 2014
posterior cardinal vein morphology, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3Fig. S1 from Herpers et al., 2008
cell fate specification disrupted, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3 from Herpers et al., 2008
dorsal aorta morphology, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3Fig. S1 from Herpers et al., 2008
blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 3Fig. S1 from Herpers et al., 2008
posterior cardinal vein endothelial cell increased amount, abnormal nim5Tg; uq2bhTg + MO1-sox18 + MO1-sox7 standard conditions Fig. 7 from Koltowska et al., 2015
dorsal aorta blood vessel endothelium EGFP expression absent, abnormal s843Tg; um13Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
posterior cardinal vein blood vessel endothelium EGFP expression absent, abnormal s843Tg; um13Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
blood vessel endothelium EGFP expression decreased amount, abnormal s843Tg; um13Tg + MO1-sox18 + MO1-sox7 standard conditions Fig. 5 from Duong et al., 2014
posterior cardinal vein blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 1 from Duong et al., 2014
dorsal aorta fused with posterior cardinal vein, abnormal s843Tg; um13Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 1 from Duong et al., 2014
dorsal aorta blood vessel development process quality, abnormal s843Tg; um13Tg + MO1-sox18 + MO3-vegfd standard conditions Fig. 1 from Duong et al., 2014
Genome Resources:
CITATIONS (6)