Morpholino

MO2-smad1

ID
ZDB-MRPHLNO-080610-2
Name
MO2-smad1
Previous Names
None
Target
Sequence
5' - TAACAATTTAGCCACGCTCACCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice block at e2i2
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-smad1
No data available
Phenotype
Phenotype resulting from MO2-smad1
No data available
Phenotype of all Fish created by or utilizing MO2-smad1
No data available
Citations