header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080515-1
Morpholino Name: MO2-unc5b
Target: unc5b (1)
Previous Name: unc5bSBMO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGGAAGACAATACAGCACCTCAGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-unc5b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-unc5b
Expressed Gene Anatomy Figures
unc5b Fig. 7 from Epting et al., 2010
PHENOTYPE
Phenotype resulting from MO2-unc5b
Phenotype of all Fish created by or utilizing MO2-unc5b
OTHER MO2-unc5b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)