ZFIN ID: ZDB-MRPHLNO-080506-3
Morpholino Name: MO4-spi1b
Target: spi1b (1)
Previous Name: MO4-spi1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATGATGTACCCCTCCATTCTGTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-spi1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-spi1b No data available
PHENOTYPE
Phenotype resulting from MO4-spi1b
No data available

Phenotype of all Fish created by or utilizing MO4-spi1b
No data available
Genome Resources:
CITATIONS (1)