ZFIN ID: ZDB-MRPHLNO-080405-1
Morpholino Name: MO4-hsp90aa1.1
Target: hsp90aa1.1 (1)
Previous Name: MO4-hsp90a.1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGACTTCTCAGGCATCTTGCTGTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-hsp90aa1.1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-hsp90aa1.1
Expressed Gene Anatomy Figures
eef1a1l1 Fig. 5 with image from Du et al., 2008
hsp90aa1.1 Fig. 5 with image from Du et al., 2008
myhz2 Fig. 5 with imageFig. S9 with image from Du et al., 2008
myod1 Fig. S7 with image from Du et al., 2008
smyhc1 Fig. 5 with imageFig. S9 with image from Du et al., 2008
unc45b Fig. 5 with image from Du et al., 2008
PHENOTYPE
Phenotype resulting from MO4-hsp90aa1.1
Phenotype of all Fish created by or utilizing MO4-hsp90aa1.1
Phenotype Fish Conditions Figures
whole organism immobile, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
pericardium edematous, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
myotome myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with imageFig. S10 with image from Du et al., 2008
slow muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with image from Du et al., 2008
muscle contraction arrested, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
skeletal muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
sarcomerogenesis disrupted, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
myotome striated muscle thin filament decreased amount, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
myotome M band disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with imageFig. S8 with image from Du et al., 2008
skeletal myofibril assembly disrupted, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with imageFig. S8 with image from Du et al., 2008
slow muscle cell sarcomere decreased amount, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
fast muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with image from Du et al., 2008
myotome Z disc disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
Genome Resources:
CITATIONS (5)