Morpholino

MO4-hsp90aa1.1

ID
ZDB-MRPHLNO-080405-1
Name
MO4-hsp90aa1.1
Previous Names
  • MO4-hsp90a.1
Target
Sequence
5' - CGACTTCTCAGGCATCTTGCTGTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-hsp90aa1.1
Phenotype
Phenotype resulting from MO4-hsp90aa1.1
Phenotype of all Fish created by or utilizing MO4-hsp90aa1.1
Phenotype Fish Conditions Figures
whole organism immobile, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
pericardium edematous, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
myotome myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with imageFig. S10 with image from Du et al., 2008
slow muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with image from Du et al., 2008
muscle contraction arrested, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
skeletal muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
sarcomerogenesis disrupted, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
myotome striated muscle thin filament decreased amount, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
myotome M band disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with imageFig. S8 with image from Du et al., 2008
skeletal myofibril assembly disrupted, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with imageFig. S8 with image from Du et al., 2008
slow muscle cell sarcomere decreased amount, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
fast muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with image from Du et al., 2008
myotome Z disc disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
Citations