ZFIN ID: ZDB-MRPHLNO-080213-5
Morpholino Name: MO1-emx3
Target: emx3 (1)
Previous Name: emx3MOe2i2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GACGTGTCTGTCTCTTACCTGCGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Binds the second exon splice acceptor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-emx3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-emx3 No data available
PHENOTYPE 
Phenotype resulting from MO1-emx3
Phenotype Figures
apoptotic process increased occurrence, abnormal Fig. 5 from Baden et al., 2007

Phenotype of all Fish created by or utilizing MO1-emx3
Phenotype Fish Conditions Figures
apoptotic process increased occurrence, abnormal WT + MO1-emx3 standard conditions Fig. 5 from Baden et al., 2007
dorsal telencephalon morphology, abnormal WT + MO1-emx3 + MO4-emx3 + MO4-tp53 standard conditions Fig. 3 with image from Viktorin et al., 2009
OTHER MO1-emx3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)