header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080212-3
Morpholino Name: MO1-fsta
Target: fsta (1)
Previous Name: MOa-fst1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGACGCTTTAGCATCCTTAGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fsta No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fsta
Expressed Gene Anatomy Figures
edn1 Fig. 8 with image from Dalcq et al., 2012
hand2 Fig. 8 with image from Dalcq et al., 2012
PHENOTYPE
Phenotype resulting from MO1-fsta
Phenotype of all Fish created by or utilizing MO1-fsta
OTHER MO1-fsta MORPHOLINO PAGESNo links to external sites
CITATIONS (2)