ZFIN ID: ZDB-MRPHLNO-080118-1
Morpholino Name: MO1-birc2
Target: birc2 (1)
Sequence:
5' - TGTCCGAGGCCCTTACCAACATAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino that targets the exon 1 - intron 1 splice junction.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-birc2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-birc2
Expressed Gene Anatomy Figures
birc2 Fig. 2 from Santoro et al., 2007
PHENOTYPE
Phenotype resulting from MO1-birc2
Phenotype of all Fish created by or utilizing MO1-birc2
Genome Resources:
CITATIONS (2)