ZFIN ID: ZDB-MRPHLNO-080108-2
Morpholino Name: MO2-sirt1
Target: sirt1 (1)
Sequence:
5' - CGAACCAAACTCACCAATCTGTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sirt1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sirt1
Expressed Gene Anatomy Figures
fli1 Fig. 6 from Potente et al., 2007
PHENOTYPE
Phenotype resulting from MO2-sirt1
Phenotype of all Fish created by or utilizing MO2-sirt1
Genome Resources:
CITATIONS (3)