ZFIN ID: ZDB-MRPHLNO-080107-3
Morpholino Name: MO2-flr
Target: flr (1)
Previous Name: flrMoex17d (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATTACCTTTTTGTTGTATGGCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-flr No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-flr No data available
PHENOTYPE
Phenotype resulting from MO2-flr
Phenotype of all Fish created by or utilizing MO2-flr
Genome Resources:
CITATIONS (1)