Morpholino

MO1-ift70

ID
ZDB-MRPHLNO-080107-2
Name
MO1-ift70
Previous Names
  • MO1-flr
  • flrMoex9d (1)
Target
Sequence
5' - TAGTACACTTACCTCATATTTACAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift70
Expressed Gene Anatomy Figures
spaw Fig. 6 from Pathak et al., 2007
Phenotype
Phenotype resulting from MO1-ift70
Phenotype Fish Figures
cilium assembly disrupted, abnormal AB/TU + MO1-ift70 Fig. 5 from Pathak et al., 2007
determination of left/right symmetry disrupted, abnormal AB/TU + MO1-ift70 Fig. 6 from Pathak et al., 2007
Kupffer's vesicle cilium decreased amount, abnormal AB/TU + MO1-ift70 Fig. 5 from Pathak et al., 2007
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO1-ift70 Fig. 5 from Pathak et al., 2007
pronephric duct microtubule disorganized, abnormal AB/TU + MO1-ift70 Fig. 7 from Pathak et al., 2007
pronephros cystic, abnormal AB/TU + MO1-ift70 Fig. 3 from Pathak et al., 2007
pronephros axoneme structure, abnormal AB/TU + MO1-ift70 Fig. 7 from Pathak et al., 2007
protein localization to cilium disrupted, abnormal WT + MO1-ift70 Fig. 5 from Zhao et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO1-ift70 Fig. 3 from Pathak et al., 2007
Phenotype of all Fish created by or utilizing MO1-ift70
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased amount, abnormal AB/TU + MO1-ift70 standard conditions Fig. 5 from Pathak et al., 2007
pronephros cystic, abnormal AB/TU + MO1-ift70 standard conditions Fig. 3 from Pathak et al., 2007
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO1-ift70 standard conditions Fig. 5 from Pathak et al., 2007
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO1-ift70 standard conditions Fig. 3 from Pathak et al., 2007
determination of left/right symmetry disrupted, abnormal AB/TU + MO1-ift70 standard conditions Fig. 6 from Pathak et al., 2007
pronephros axoneme structure, abnormal AB/TU + MO1-ift70 standard conditions Fig. 7 from Pathak et al., 2007
cilium assembly disrupted, abnormal AB/TU + MO1-ift70 standard conditions Fig. 5 from Pathak et al., 2007
pronephric duct microtubule disorganized, abnormal AB/TU + MO1-ift70 standard conditions Fig. 7 from Pathak et al., 2007
protein localization to cilium disrupted, abnormal WT + MO1-ift70 standard conditions Fig. 5 from Zhao et al., 2011
neuromast hair cell disoriented, abnormal WT + MO1-ift70 + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
establishment of planar polarity disrupted, abnormal WT + MO1-ift70 + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
spinal cord cilium decreased length, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 2 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 6,  Fig. S4 from Zhao et al., 2011
olfactory pit cilium decreased length, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 2,  Fig. S4 from Zhao et al., 2011
protein localization to cilium disrupted, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 5 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 6 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-ift70 + MO2-ift52 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-ift70 + MO2-ift52 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-ift70 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO1-ift70 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.