ZFIN ID: ZDB-MRPHLNO-080107-2
Morpholino Name: MO1-flr
Target: flr (1)
Previous Name: flrMoex9d (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAGTACACTTACCTCATATTTACAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-flr No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-flr
Expressed Gene Anatomy Figures
spaw Fig. 6 from Pathak et al., 2007
PHENOTYPE
Phenotype resulting from MO1-flr
Phenotype of all Fish created by or utilizing MO1-flr
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased amount, abnormal AB/TU + MO1-flr standard conditions Fig. 5 from Pathak et al., 2007
pronephros cystic, abnormal AB/TU + MO1-flr standard conditions Fig. 3 from Pathak et al., 2007
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO1-flr standard conditions Fig. 5 from Pathak et al., 2007
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO1-flr standard conditions Fig. 3 from Pathak et al., 2007
determination of left/right symmetry disrupted, abnormal AB/TU + MO1-flr standard conditions Fig. 6 from Pathak et al., 2007
pronephros axoneme structure, abnormal AB/TU + MO1-flr standard conditions Fig. 7 from Pathak et al., 2007
cilium assembly disrupted, abnormal AB/TU + MO1-flr standard conditions Fig. 5 from Pathak et al., 2007
pronephric duct microtubule disorganized, abnormal AB/TU + MO1-flr standard conditions Fig. 7 from Pathak et al., 2007
protein localization to cilium disrupted, abnormal WT + MO1-flr standard conditions Fig. 5 from Zhao et al., 2011
neuromast hair cell disoriented, abnormal WT + MO1-flr + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
establishment of planar polarity disrupted, abnormal WT + MO1-flr + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
spinal cord cilium decreased length, abnormal WT + MO1-flr + MO2-b9d2 standard conditions Fig. 2 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO1-flr + MO2-b9d2 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-flr + MO2-b9d2 standard conditions Fig. 6Fig. S4 from Zhao et al., 2011
olfactory pit cilium decreased length, abnormal WT + MO1-flr + MO2-b9d2 standard conditions Fig. 2Fig. S4 from Zhao et al., 2011
protein localization to cilium disrupted, abnormal WT + MO1-flr + MO2-b9d2 standard conditions Fig. 5 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-flr + MO2-b9d2 standard conditions Fig. 6 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-flr + MO2-ift52 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-flr + MO2-ift52 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-flr + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO1-flr + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
Genome Resources:
CITATIONS (2)