header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080104-1
Morpholino Name: MO3-cyp26b1
Target: cyp26b1 (1)
Previous Names: cyp26b1 MO (1), Cyp26B1-splice-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTACTCGCGCTTAACCTGAAAGAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cyp26b1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cyp26b1
Expressed Gene Anatomy Figures
cyp26b1 Fig. 1 from Reijntjes et al., 2007
dlx2a Fig. 5 from Reijntjes et al., 2007
egr2b Fig. 3 from Reijntjes et al., 2007
hoxb1a Fig. 3 from Reijntjes et al., 2007
hoxb3a Fig. 3 from Reijntjes et al., 2007
PHENOTYPE
Phenotype resulting from MO3-cyp26b1
Phenotype Figures
epibranchial ganglion disorganized, abnormal Fig. 4 from Reijntjes et al., 2007
epibranchial ganglion neuron decreased amount, abnormal Fig. 4 from Reijntjes et al., 2007
eye decreased size, abnormal Fig. 5 from Reijntjes et al., 2007
head decreased size, abnormal Fig. 2Fig. 5 from Reijntjes et al., 2007
hindbrain decreased size, abnormal Fig. 4 from Reijntjes et al., 2007
hindbrain morphology, abnormal Fig. 3 from Reijntjes et al., 2007
hindbrain development disrupted, abnormal Fig. 3Fig. 4 from Reijntjes et al., 2007
mandibular arch skeleton malformed, abnormal Fig. 6 from Reijntjes et al., 2007
Meckel's cartilage aplastic, abnormal Fig. 5 from Reijntjes et al., 2007
mouth decreased size, abnormal Fig. 5 from Reijntjes et al., 2007
neurocranium malformed, abnormal Fig. 6 from Reijntjes et al., 2007
optic cup decreased size, abnormal Fig. 2 from Reijntjes et al., 2007
otic vesicle decreased size, abnormal Fig. 2 from Reijntjes et al., 2007
palatoquadrate cartilage aplastic, abnormal Fig. 5 from Reijntjes et al., 2007
pharyngeal arch aplastic, abnormal Fig. 6 from Reijntjes et al., 2007
pharyngeal arch malformed, abnormal Fig. 6 from Reijntjes et al., 2007
pharyngeal arch 3-7 aplastic, abnormal Fig. 6 from Reijntjes et al., 2007
pharyngeal arch 3-7 malformed, abnormal Fig. 6 from Reijntjes et al., 2007
rhombomere 3 decreased width, abnormal Fig. 3 from Reijntjes et al., 2007
rhombomere 4 decreased size, abnormal Fig. 3 from Reijntjes et al., 2007
rhombomere 5 decreased width, abnormal Fig. 3 from Reijntjes et al., 2007
trabecula cranii aplastic, abnormal Fig. 5 from Reijntjes et al., 2007

Phenotype of all Fish created by or utilizing MO3-cyp26b1
Phenotype Fish Conditions Figures
pharyngeal arch 3-7 aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
rhombomere 5 decreased width, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
hindbrain morphology, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
palatoquadrate cartilage aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
trabecula cranii aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
rhombomere 4 decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
pharyngeal arch malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
mandibular arch skeleton malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
eye decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
pharyngeal arch 3-7 malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
neurocranium malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
rhombomere 3 decreased width, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
mouth decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
optic cup decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 2 from Reijntjes et al., 2007
pharyngeal arch aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
head decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 2Fig. 5 from Reijntjes et al., 2007
Meckel's cartilage aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
hindbrain development disrupted, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
otic vesicle decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 2 from Reijntjes et al., 2007
hindbrain development disrupted, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
epibranchial ganglion neuron decreased amount, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
hindbrain decreased size, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
epibranchial ganglion disorganized, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
OTHER MO3-cyp26b1 MORPHOLINO PAGES No links to external sites
CITATIONS (1)