Morpholino

MO2-prickle1b

ID
ZDB-MRPHLNO-071221-4
Name
MO2-prickle1b
Previous Names
  • Pk1b-MO-SD-E6I6 (1)
Target
Sequence
5' - TTAATGAAACTCACCAATATTCTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking morpholino against the exon6-intron6 boundary.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prickle1b
No data available
Phenotype
Phenotype resulting from MO2-prickle1b
No data available
Phenotype of all Fish created by or utilizing MO2-prickle1b
Phenotype Fish Conditions Figures
facial nerve motor nucleus mislocalised anteriorly, abnormal WT + MO1-prickle1b + MO2-prickle1b standard conditions Fig. S3 with image from Mapp et al., 2011
rhombomere 4 development disrupted, abnormal WT + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 6 with image from Rohrschneider et al., 2007
facial nerve motor nucleus motor neuron mislocalised, abnormal WT + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 6 with image from Rohrschneider et al., 2007
neuron migration process quality, abnormal WT + MO1-prickle1b + MO2-prickle1b standard conditions Fig. S3 with image from Mapp et al., 2011
hindbrain tangential cell migration disrupted, abnormal WT + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 6 with image from Rohrschneider et al., 2007
convergent extension involved in axis elongation process quality, abnormal WT + MO1-prickle1b + MO2-prickle1b control Fig. S1 with image from Mapp et al., 2010
neuron migration process quality, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 4 with image from Mapp et al., 2011
facial nerve motor nucleus nucleus physical object quality, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 6 with image,  Fig. S6 with image from Mapp et al., 2011
protein localization to nucleus process quality, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 6 with image,  Fig. S6 with image from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 4 with image from Mapp et al., 2011
branchiomotor neuron rhombomere 6 absent, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 4 with image,  Fig. 5,  Fig. 6 with image from Mapp et al., 2010
branchiomotor neuron neuron projection amount, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 3 from Mapp et al., 2010
branchiomotor neuron accumulation rhombomere 4, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 2 with image,  Fig. 3,  Fig. 4 with image,  Fig. 5,  Fig. 6 with image from Mapp et al., 2010
branchiomotor neuron motor neuron migration process quality, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 2 with image,  Fig. 3,  Fig. 4 with image from Mapp et al., 2010
branchiomotor neuron centrosome position, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 6 with image from Mapp et al., 2010
branchiomotor neuron decreased speed, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 2 with image from Mapp et al., 2010
branchiomotor neuron neuron projection orientation rhombomere 4, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 3 from Mapp et al., 2010
branchiomotor neuron cell body orientation branchiomotor neuron axon, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 4 with image,  Fig. 5 from Mapp et al., 2010
branchiomotor neuron cell body shape, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 4 with image from Mapp et al., 2010
branchiomotor neuron rhombomere 5 absent, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 4 with image,  Fig. 5,  Fig. 6 with image from Mapp et al., 2010
branchiomotor neuron neuron projection length, abnormal ch100Tg + MO1-prickle1b + MO2-prickle1b (AB) control Fig. 3 from Mapp et al., 2010
neuron migration process quality, abnormal rw0Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 2 with image from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal rw0Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. 2 with image from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal hmgcrbs617/+; rw0Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. S3 with image from Mapp et al., 2011
neuron migration process quality, abnormal hmgcrbs617/+; rw0Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. S3 with image from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal hmgcrbs617/s617; rw0Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. S3 with image from Mapp et al., 2011
neuron migration process quality, abnormal hmgcrbs617/s617; rw0Tg + MO1-prickle1b + MO2-prickle1b standard conditions Fig. S3 with image from Mapp et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.