header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-071211-2
Morpholino Name: MO3-lmo4a
Target: lmo4a (1)
Previous Name: MO3-lmo4 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACGTATCTCGAAGGTCAAAGGGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-lmo4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-lmo4a No data available
PHENOTYPE
Phenotype resulting from MO3-lmo4a
No data available

Phenotype of all Fish created by or utilizing MO3-lmo4a
Phenotype Fish Conditions Figures
pectoral fin morphology, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
optic vesicle increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
hypothalamus increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
eye increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
diencephalon increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
cell population proliferation increased occurrence, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 6 with image from McCollum et al., 2007
otic vesicle morphology, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
diencephalon increased length, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 4 with image from McCollum et al., 2007
optic vesicle has extra parts of type neurectodermal cell, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 6 with image from McCollum et al., 2007
head increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
cell migration disrupted, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 6 with image from McCollum et al., 2007
head morphology, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
optic stalk increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
retina increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
telencephalon increased length, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with imageFig. 4 with image from McCollum et al., 2007
neural plate increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 5 with image from McCollum et al., 2007
OTHER MO3-lmo4a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)