ZFIN ID: ZDB-MRPHLNO-071205-7
Morpholino Name: MO1-nrp1b
Target: nrp1b (1)
Previous Name: nrp1b AMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACACAGAGCAAACACCAGTACATCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nrp1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nrp1b No data available
PHENOTYPE
Phenotype resulting from MO1-nrp1b
Phenotype of all Fish created by or utilizing MO1-nrp1b
Genome Resources:
CITATIONS (2)