Morpholino

MO3-hsp90aa1.1

ID

ZDB-MRPHLNO-071129-5

Name

MO3-hsp90aa1.1

Previous Names

MO3-hsp90a.1

Target

hsp90aa1.1 (1)

Sequence

5' - CGCTGTATTTCCTCTTCTCCACCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-hsp90aa1.1

No data available

Phenotype

Phenotype resulting from MO3-hsp90aa1.1

Phenotype	Fish	Figures
head decreased size, abnormal	WT + MO3-hsp90aa1.1	Fig. 5 from Pei et al., 2007
head necrotic, abnormal	WT + MO3-hsp90aa1.1	Fig. 3 from Pei et al., 2009
post-vent region decreased length, abnormal	WT + MO3-hsp90aa1.1	Fig. 3 from Pei et al., 2009
somite U-shaped, abnormal	WT + MO3-hsp90aa1.1	Fig. 5 from Pei et al., 2007
whole organism decreased length, abnormal	WT + MO3-hsp90aa1.1	Fig. 5 from Pei et al., 2007

Phenotype of all Fish created by or utilizing MO3-hsp90aa1.1

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	WT + MO3-hsp90aa1.1	standard conditions	Fig. 5 from Pei et al., 2007
head necrotic, abnormal	WT + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
post-vent region decreased length, abnormal	WT + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
somite U-shaped, abnormal	WT + MO3-hsp90aa1.1	standard conditions	Fig. 5 from Pei et al., 2007
whole organism decreased length, abnormal	WT + MO3-hsp90aa1.1	standard conditions	Fig. 5 from Pei et al., 2007
eye decreased amount, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
eye fused with eye, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 5 from Pei et al., 2007
eye malformed, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
head decreased size, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 5 from Pei et al., 2007
embryonic axis specification disrupted, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
trunk anterior-posterior axis bifurcated, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
post-vent region decreased length, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
somite U-shaped, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 5 from Pei et al., 2007
trunk duplicated, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
head necrotic, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009
whole organism decreased length, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 5 from Pei et al., 2007
eye mislocalised, abnormal	ndr1^{hi975Tg/hi975Tg} + MO3-hsp90aa1.1	standard conditions	Fig. 3 from Pei et al., 2009

Citations