ZFIN ID: ZDB-MRPHLNO-071129-5
Morpholino Name: MO3-hsp90aa1.1
Target: hsp90aa1.1 (1)
Previous Name: MO3-hsp90a.1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCTGTATTTCCTCTTCTCCACCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-hsp90aa1.1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-hsp90aa1.1 No data available
PHENOTYPE
Phenotype resulting from MO3-hsp90aa1.1
Phenotype of all Fish created by or utilizing MO3-hsp90aa1.1
Phenotype Fish Conditions Figures
head decreased size, abnormal WT + MO3-hsp90aa1.1 standard conditions Fig. 5 with image from Pei et al., 2007
head necrotic, abnormal WT + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
post-vent region decreased length, abnormal WT + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
somite U-shaped, abnormal WT + MO3-hsp90aa1.1 standard conditions Fig. 5 with image from Pei et al., 2007
whole organism decreased length, abnormal WT + MO3-hsp90aa1.1 standard conditions Fig. 5 with image from Pei et al., 2007
eye decreased amount, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
eye fused with eye, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 5 with image from Pei et al., 2007
eye malformed, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
head decreased size, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 5 with image from Pei et al., 2007
embryonic axis specification disrupted, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
trunk anterior-posterior axis bifurcated, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
post-vent region decreased length, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
somite U-shaped, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 5 with image from Pei et al., 2007
trunk duplicated, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
head necrotic, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
eye mislocalised, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 3 with image from Pei et al., 2009
whole organism decreased length, abnormal ndr1hi975Tg/hi975Tg + MO3-hsp90aa1.1 standard conditions Fig. 5 with image from Pei et al., 2007
Genome Resources:
CITATIONS (2)