ZFIN ID: ZDB-MRPHLNO-071129-3
Morpholino Name: MO1-tbp
Target: tbp (1)
Sequence:
5' - GAGGTAGGCTGTTGTTCTGCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tbp No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tbp
Expressed Gene Anatomy Figures
acp5a Fig. S1Fig. S2 from Ferg et al., 2007
alcamb Fig. S1Fig. S2 from Ferg et al., 2007
amt Fig. S1Fig. S2 from Ferg et al., 2007
anxa1a Fig. S1Fig. S2 from Ferg et al., 2007
anxa1b Fig. S1Fig. S2 from Ferg et al., 2007
apoeb Fig. S1Fig. S2 from Ferg et al., 2007
arhgap11a Fig. S1 from Ferg et al., 2007
asb8 Fig. S1Fig. S2 from Ferg et al., 2007
birc5b Fig. S1 from Ferg et al., 2007
btr30 Fig. S1Fig. S2 from Ferg et al., 2007
casp3a Fig. S1Fig. S2 from Ferg et al., 2007
cdca4 Fig. S1Fig. S2 from Ferg et al., 2007
cnppd1 Fig. 5 from Ferg et al., 2007
cpeb1b Fig. 3Fig. 4 from Ferg et al., 2007
cse1l Fig. 5 from Ferg et al., 2007
dck Fig. 1 from Hart et al., 2007
dnajc5ga Fig. 5 from Ferg et al., 2007
dynll2a Fig. 4 from Ferg et al., 2007
eef1b2 Fig. S1 from Ferg et al., 2007
gngt2a Fig. S1Fig. S2 from Ferg et al., 2007
gpia Fig. 5 from Ferg et al., 2007
gsc Fig. S5 from Ferg et al., 2007
gyg1a Fig. 5Fig. S1 from Ferg et al., 2007
her7 Fig. S1 from Ferg et al., 2007
hnf4a Fig. S1Fig. S2 from Ferg et al., 2007
irf2bp2a Fig. 5 from Ferg et al., 2007
krt4 Fig. S1Fig. S2 from Ferg et al., 2007
ldhd Fig. S1Fig. S2 from Ferg et al., 2007
ldlrap1a Fig. S1Fig. S2 from Ferg et al., 2007
mcl1a Fig. S1 from Ferg et al., 2007
mespaa Fig. 1 from Hart et al., 2007
mir430a-5 Fig. S5 from Ferg et al., 2007
mir430b-10 Fig. S5 from Ferg et al., 2007
mir430c-1 Fig. S5 from Ferg et al., 2007
opa1 Fig. S1Fig. S2 from Ferg et al., 2007
papss2b Fig. S1Fig. S2 from Ferg et al., 2007
pgam1b Fig. 5 from Ferg et al., 2007
phc2a Fig. 5 from Ferg et al., 2007
phgdh Fig. 5 from Ferg et al., 2007
pik3r3b Fig. S1 from Ferg et al., 2007
ppp1r14aa Fig. S1Fig. S2 from Ferg et al., 2007
pygmb Fig. S1 from Ferg et al., 2007
raver1 Fig. S1Fig. S2 from Ferg et al., 2007
rogdi Fig. 5 from Ferg et al., 2007
rtkn2a Fig. 5 from Ferg et al., 2007
sgk1 Fig. S1 from Ferg et al., 2007
sh3bp5b Fig. S1Fig. S2 from Ferg et al., 2007
smad2 Fig. 3Fig. 4Fig. S1Fig. S2 from Ferg et al., 2007
sp5l Fig. S1Fig. S2 from Ferg et al., 2007
syncrip Fig. 1 from Hart et al., 2007
tbp Fig. S1 from Hart et al., 2007
tbpl2 Fig. S1 from Hart et al., 2007
tbx16 Fig. S1 from Ferg et al., 2007
tbxta Fig. S5 from Ferg et al., 2007
Fig. 1 from Hart et al., 2007
tcirg1b Fig. 4 from Ferg et al., 2007
thy1 Fig. S1Fig. S2 from Ferg et al., 2007
tmem30ab Fig. 5 from Ferg et al., 2007
tram1 Fig. S1 from Ferg et al., 2007
txnrd3 Fig. 5 from Ferg et al., 2007
zfand5a Fig. S1Fig. S2 from Ferg et al., 2007
zgc:55461 Fig. 4Fig. S1Fig. S2 from Ferg et al., 2007
zgc:92027 Fig. S1Fig. S2 from Ferg et al., 2007
znf703 Fig. S1Fig. S2 from Ferg et al., 2007
PHENOTYPE
Phenotype resulting from MO1-tbp
Phenotype of all Fish created by or utilizing MO1-tbp
Genome Resources:
CITATIONS (4)