Morpholino

MO1-cd2ap

ID
ZDB-MRPHLNO-071114-1
Name
MO1-cd2ap
Previous Names
  • MO1-cd2apl
Target
Sequence
5' - CATACTCCACCACCACCTCAACCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cd2ap
Phenotype
Phenotype resulting from MO1-cd2ap
Phenotype Fish Figures
glomerular filtration disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 Fig. S8 from Schiffer et al., 2015
Fig. S4 from Yeo et al., 2015
Fig. 3 from Hentschel et al., 2007
ocular blood vessel EGFP expression decreased amount, abnormal lri500Tg + MO1-cd2ap Fig. 4 from Tossidou et al., 2019
pericardium edematous, abnormal AB + MO1-cd2ap Fig. 7 with image from Kuusela et al., 2016
Fig. 1 from Hentschel et al., 2007
podocyte structure, abnormal AB + MO1-cd2ap Fig. 1 from Hentschel et al., 2007
podocyte development disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 Fig. S4 from Yeo et al., 2015
pronephric glomerular basement membrane increased permeability, abnormal WT + MO1-cd2ap + MO4-tp53 Fig. S4 from Yeo et al., 2015
pronephric glomerular capillary distended, abnormal WT + MO1-cd2ap Fig. 7 with image from Kuusela et al., 2016
pronephric glomerulus morphology, abnormal WT + MO1-cd2ap Fig. 7 with image from Kuusela et al., 2016
protein poly-ADP-ribosylation increased occurrence, abnormal WT + MO1-cd2ap Fig. 7 with image from Kuusela et al., 2016
whole organism nphs2 expression decreased amount, abnormal WT + MO1-cd2ap Fig. 7 with image from Kuusela et al., 2016
whole organism decreased life span, abnormal AB + MO1-cd2ap Fig. S8 from Schiffer et al., 2015
whole organism edematous, abnormal lri500Tg + MO1-cd2ap Fig. 4 from Tossidou et al., 2019
whole organism ctnnb1 expression increased amount, abnormal WT + MO1-cd2ap Fig. 7 with image from Kuusela et al., 2016
whole organism lethal (sensu genetics), abnormal AB + MO1-cd2ap text only from Hentschel et al., 2007
Phenotype of all Fish created by or utilizing MO1-cd2ap
Phenotype Fish Conditions Figures
glomerular filtration disrupted, abnormal AB + MO1-cd2ap standard conditions Fig. S8 from Schiffer et al., 2015
Fig. 3 from Hentschel et al., 2007
whole organism lethal (sensu genetics), abnormal AB + MO1-cd2ap standard conditions text only from Hentschel et al., 2007
podocyte structure, abnormal AB + MO1-cd2ap standard conditions Fig. 1 from Hentschel et al., 2007
whole organism decreased life span, abnormal AB + MO1-cd2ap standard conditions Fig. S8 from Schiffer et al., 2015
pericardium edematous, abnormal AB + MO1-cd2ap standard conditions Fig. 1 from Hentschel et al., 2007
whole organism nphs2 expression decreased amount, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
yolk syncytial layer edematous, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
protein poly-ADP-ribosylation increased occurrence, abnormal WT + MO1-cd2ap standard conditions Fig. 7 with image from Kuusela et al., 2016
whole organism ctnnb1 expression increased amount, abnormal WT + MO1-cd2ap standard conditions Fig. 7 with image from Kuusela et al., 2016
pronephric glomerular capillary distended, abnormal WT + MO1-cd2ap standard conditions Fig. 7 with image from Kuusela et al., 2016
pronephric capsular space dilated, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
pronephric glomerulus dilated, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
proximal convoluted tubule dilated, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
whole organism ctnnb1 expression increased amount, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
pronephric glomerulus morphology, abnormal WT + MO1-cd2ap standard conditions Fig. 7 with image from Kuusela et al., 2016
pericardium edematous, abnormal WT + MO1-cd2ap standard conditions Fig. 7 with image from Kuusela et al., 2016
pericardium edematous, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
whole organism nphs2 expression decreased amount, abnormal WT + MO1-cd2ap standard conditions Fig. 7 with image from Kuusela et al., 2016
pronephric glomerulus cystic, abnormal WT + MO1-cd2ap chemical treatment: XAV939 Fig. 7 with image from Kuusela et al., 2016
glomerular filtration disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
podocyte development disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
pronephric glomerular basement membrane increased permeability, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
ocular blood vessel EGFP expression decreased amount, abnormal lri500Tg + MO1-cd2ap standard conditions Fig. 4 from Tossidou et al., 2019
whole organism edematous, abnormal lri500Tg + MO1-cd2ap standard conditions Fig. 4 from Tossidou et al., 2019
Citations