header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070629-1
Morpholino Name: MO1-rps6ka3a
Target: rps6ka3a (1)
Previous Name: MO1-rps6ka3

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAGTCTTCAACTTACGTGAACAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rps6ka3a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rps6ka3a No data available
PHENOTYPE
Phenotype resulting from MO1-rps6ka3a
Phenotype of all Fish created by or utilizing MO1-rps6ka3a
OTHER MO1-rps6ka3a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)