Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-rps6ka3a

ID
ZDB-MRPHLNO-070629-1
Name
MO1-rps6ka3a
Previous Names
  • MO1-rps6ka3
Target
Sequence
5' - CAGTCTTCAACTTACGTGAACAAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rps6ka3a
No data available
Phenotype
Phenotype resulting from MO1-rps6ka3a
Phenotype of all Fish created by or utilizing MO1-rps6ka3a
Citations