ZFIN ID: ZDB-MRPHLNO-070615-1
Morpholino Name: MO4-jag1b
Target: jag1b (1)
Previous Name: jagged1b-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAATCAAGACTCACCGTCGTCCGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-jag1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-jag1b
Expressed Gene Anatomy Figures
gad1b Fig. 1 from Yeo et al., 2007
her4.1 Fig. 8 from Yeo et al., 2007
isl1 Fig. 1 from Yeo et al., 2007
isl2a Fig. 1 from Yeo et al., 2007
nkx2.2b Fig. 8 from Yeo et al., 2007
PHENOTYPE
Phenotype resulting from MO4-jag1b
No data available

Phenotype of all Fish created by or utilizing MO4-jag1b
No data available
Genome Resources:
CITATIONS (3)