header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070614-6
Morpholino Name: MO3-her9
Target: her9 (1)
Sequence:
5' - AGTGAATATATTCCGTGTGTGGTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: binds UTR (-62 to -38)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-her9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-her9
Expressed Gene Anatomy Figures
rfx2 Fig. 5 with image from Ma et al., 2007
PHENOTYPE
Phenotype resulting from MO3-her9
No data available

Phenotype of all Fish created by or utilizing MO3-her9
No data available
OTHER MO3-her9 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)