header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070605-1
Morpholino Name: MO3-etv2
Target: etv2 (1)
Previous Name: MO3-ets1b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTTTTGACAGTGCCTCAGCTCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targets -10 to -34 of the 5' UTR
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-etv2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-etv2 No data available
PHENOTYPE
Phenotype resulting from MO3-etv2
Phenotype of all Fish created by or utilizing MO3-etv2
Phenotype Fish Conditions Figures
intersegmental vessel decreased amount, abnormal WT + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
angiogenesis disrupted, abnormal WT + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
intersegmental vessel aplastic, abnormal WT + MO1-fli1a + MO1-fli1b + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
angiogenesis disrupted, abnormal WT + MO1-fli1a + MO1-fli1b + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
angiogenesis disrupted, abnormal WT + MO1-fli1a + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
intersegmental vessel aplastic, abnormal WT + MO1-fli1a + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
intersegmental vessel decreased amount, abnormal WT + MO1-fli1a + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
angiogenesis disrupted, abnormal WT + MO1-fli1b + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
intersegmental vessel aplastic, abnormal WT + MO1-fli1b + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
intersegmental vessel decreased amount, abnormal WT + MO1-fli1b + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
angiogenesis disrupted, abnormal WT + MO1-fli1a + MO1-fli1b + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
intersegmental vessel decreased amount, abnormal WT + MO1-fli1a + MO1-fli1b + MO2-ets1 + MO3-etv2 standard conditions Fig. 7 from Pham et al., 2007
vasculature development disrupted, abnormal s843Tg; sd2Tg + MO2-foxc1a + MO3-etv2 standard conditions Fig. 4 with image from De Val et al., 2008
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO2-foxc1a + MO3-etv2 standard conditions Fig. 4 with image from De Val et al., 2008
Genome Resources:
CITATIONS (4)