ZFIN ID: ZDB-MRPHLNO-070604-2
Morpholino Name: MO3-dkk1b
Target: dkk1b (1)
Previous Name: MO3-dkk1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAGAGAGCATGGCGATGTGCATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-dkk1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-dkk1b
Expressed Gene Anatomy Figures
bmp4 Fig. 2 from Caneparo et al., 2007
ctslb Fig. 6Fig. S1 from Caneparo et al., 2007
dlx3b Fig. 6 from Caneparo et al., 2007
gsc Fig. 2 from Caneparo et al., 2007
lft1 Fig. 2Fig. 4 from Caneparo et al., 2007
sox19b Fig. 2 from Caneparo et al., 2007
spry4 Fig. 2 from Caneparo et al., 2007
tbxta Fig. 6Fig. S1 from Caneparo et al., 2007
wnt11f2 Fig. S2 from Caneparo et al., 2007
PHENOTYPE
Phenotype resulting from MO3-dkk1b
Phenotype of all Fish created by or utilizing MO3-dkk1b
Genome Resources:
CITATIONS (3)