ZFIN ID: ZDB-MRPHLNO-070604-1
Morpholino Name: MO2-dkk1b
Target: dkk1b (1)
Previous Name: MO2-dkk1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATTGTAGGATGTATTCCCTGGGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-dkk1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-dkk1b
Expressed Gene Anatomy Figures
egr2b Fig. 8 with image from Kagermeier-Schenk et al., 2011
foxg1a Fig. 1 with image from Bielen et al., 2012
myod1 Fig. 8 with image from Kagermeier-Schenk et al., 2011
pax2a Fig. 8 with image from Kagermeier-Schenk et al., 2011
rx3 Fig. 1 with image from Bielen et al., 2012
PHENOTYPE
Phenotype resulting from MO2-dkk1b
Phenotype of all Fish created by or utilizing MO2-dkk1b
Genome Resources:
CITATIONS (5)