ZFIN ID: ZDB-MRPHLNO-070529-5
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.
Morpholino Name: MO1-smad2
Target: smad2 (1)
Sequence:
5' - GAGTGAAAGGCAAGATGGAGGACAT - 3'
   
Select Sequence Analysis Tool
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-smad2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-smad2 No data available
PHENOTYPE
Phenotype resulting from MO1-smad2
Phenotype Figures
cranial vasculature morphology, abnormal Fig. 6 with image from Choi et al., 2007
dorsal aorta morphology, abnormal Fig. 6 with image from Choi et al., 2007
floor plate aplastic, abnormal Fig. S5 with image from Esguerra et al., 2007
head anterior-most region truncated, abnormal Fig. S5 with image from Esguerra et al., 2007
oocyte maturation decreased occurrence, abnormal Fig. 4 from Tan et al., 2009
posterior cardinal vein morphology, abnormal Fig. 6 with image from Choi et al., 2007
whole organism decreased length, abnormal Fig. S5 with image from Esguerra et al., 2007
whole organism increased curvature, abnormal Fig. S5 with image from Esguerra et al., 2007

Phenotype of all Fish created by or utilizing MO1-smad2
Phenotype Fish Conditions Figures
whole organism increased curvature, abnormal WT + MO1-smad2 standard conditions Fig. S5 with image from Esguerra et al., 2007
head anterior-most region truncated, abnormal WT + MO1-smad2 standard conditions Fig. S5 with image from Esguerra et al., 2007
whole organism decreased length, abnormal WT + MO1-smad2 standard conditions Fig. S5 with image from Esguerra et al., 2007
oocyte maturation decreased occurrence, abnormal WT + MO1-smad2 chemical treatment: Chorionic gonadotropin Fig. 4 from Tan et al., 2009
floor plate aplastic, abnormal WT + MO1-smad2 standard conditions Fig. S5 with image from Esguerra et al., 2007
oocyte maturation decreased occurrence, abnormal WT + MO1-smad2 chemical treatment: Activin A Fig. 4 from Tan et al., 2009
oocyte maturation decreased occurrence, abnormal WT + MO1-smad2 standard conditions Fig. 4 from Tan et al., 2009
cranial vasculature morphology, abnormal la116Tg + MO1-smad2(AB) standard conditions Fig. 6 with image from Choi et al., 2007
dorsal aorta morphology, abnormal la116Tg + MO1-smad2(AB) standard conditions Fig. 6 with image from Choi et al., 2007
posterior cardinal vein morphology, abnormal la116Tg + MO1-smad2(AB) standard conditions Fig. 6 with image from Choi et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-smad2 + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
OTHER MO1-smad2 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)