ZFIN ID: ZDB-MRPHLNO-070522-4
Morpholino Name: MO1-aplnrb
Target: aplnrb (1)
Previous Name: MO1-agtrl1b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAGAGAAGTTGTTTGTCATGTGCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-aplnrb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-aplnrb
Expressed Gene Anatomy Figures
dlc Fig. 2 from Zeng et al., 2007
dlx3b Fig. 2 from Zeng et al., 2007
egr2b Fig. 2 from Zeng et al., 2007
myl7 Fig. 3 from Zeng et al., 2007
myod1 Fig. 3 from Zeng et al., 2007
shha Fig. 2 from Zeng et al., 2007
tbxta Fig. 5 from Zeng et al., 2007
PHENOTYPE
Phenotype resulting from MO1-aplnrb
Phenotype of all Fish created by or utilizing MO1-aplnrb
Genome Resources:
CITATIONS (6)