ZFIN ID: ZDB-MRPHLNO-070522-2
Morpholino Name: MO2-zic2a
Target: zic2a (1)
Previous Names: 2MOB (1), zic2a PROX (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTCTTTCAAGCAGTCTATTCACGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-zic2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-zic2a No data available
PHENOTYPE
Phenotype resulting from MO2-zic2a
No data available

Phenotype of all Fish created by or utilizing MO2-zic2a
Phenotype Fish Conditions Figures
diencephalon development disrupted, abnormal AB + MO1-zic2a + MO2-zic2a standard conditions Fig. S2 with image from Sanek et al., 2008
ventral thalamus decreased size, abnormal AB + MO1-zic2a + MO2-zic2a standard conditions Fig. S2 with image from Sanek et al., 2008
midbrain malformed, abnormal WT + MO1-zic2a + MO2-zic2a standard conditions Fig. 7 with image from Nyholm et al., 2007
hindbrain malformed, abnormal WT + MO1-zic2a + MO2-zic2a standard conditions Fig. 7 with image from Nyholm et al., 2007
OTHER MO2-zic2a MORPHOLINO PAGESNo links to external sites
CITATIONS (6)