Morpholino

MO1-rap1b

ID
ZDB-MRPHLNO-070519-2
Name
MO1-rap1b
Previous Names
  • rap1b ATG MO (1)
Target
Sequence
5' - ACGCATTGTGCAGTGTGTCCGTTAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rap1b
Expressed Gene Anatomy Figures
bmp4 Fig. S3 from Tsai et al., 2007
dlx3b Fig. 6,  Fig. S3 from Tsai et al., 2007
her1 Fig. 3 with image from Lackner et al., 2013
mespba Fig. 3 with image from Lackner et al., 2013
myod1 Fig. 3 with image from Lackner et al., 2013
Fig. S3 from Tsai et al., 2007
ripply1 Fig. 3 with image from Lackner et al., 2013
shha Fig. 6 from Tsai et al., 2007
tbxta Fig. S3 from Tsai et al., 2007
Phenotype
Phenotype resulting from MO1-rap1b
Phenotype Fish Figures
axis increased width, abnormal WT + MO1-rap1b Fig. 6 from Tsai et al., 2007
caudal fin morphology, abnormal WT + MO1-rap1b Fig. 1 with image from Lackner et al., 2013
cell accumulation tail bud dorsal side, abnormal WT + MO1-rap1b Fig. 1 with image from Lackner et al., 2013
convergent extension delayed, abnormal WT + MO1-rap1b Fig. S3 from Tsai et al., 2007
eye decreased amount, abnormal WT + MO1-rap1b Fig. 6 from Tsai et al., 2007
eye fused with eye, abnormal WT + MO1-rap1b Fig. 6 from Tsai et al., 2007
eye position, abnormal WT + MO1-rap1b Fig. 6 from Tsai et al., 2007
neural plate increased width, abnormal WT + MO1-rap1b Fig. 6 from Tsai et al., 2007
notochord increased width, abnormal WT + MO1-rap1b Fig. S3 from Tsai et al., 2007
prechordal plate structure, abnormal WT + MO1-rap1b Fig. S3,  text only from Tsai et al., 2007
somite shape, abnormal WT + MO1-rap1b Fig. 1 with image from Lackner et al., 2013
somite size, abnormal WT + MO1-rap1b Fig. 1 with image from Lackner et al., 2013
whole organism decreased length, abnormal WT + MO1-rap1b Fig. 1 with image from Lackner et al., 2013
Fig. 6,  Fig. S2,  Fig. S3 from Tsai et al., 2007
whole organism increased curvature, abnormal WT + MO1-rap1b Fig. 6,  Fig. S2 from Tsai et al., 2007
whole organism anterior-posterior axis truncated, abnormal WT + MO1-rap1b Fig. 1 with image from Lackner et al., 2013
Phenotype of all Fish created by or utilizing MO1-rap1b
Phenotype Fish Conditions Figures
notochord increased width, abnormal WT + MO1-rap1b standard conditions Fig. S3 from Tsai et al., 2007
eye position, abnormal WT + MO1-rap1b standard conditions Fig. 6 from Tsai et al., 2007
somite size, abnormal WT + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
eye fused with eye, abnormal WT + MO1-rap1b standard conditions Fig. 6 from Tsai et al., 2007
axis increased width, abnormal WT + MO1-rap1b standard conditions Fig. 6 from Tsai et al., 2007
cell accumulation tail bud dorsal side, abnormal WT + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
neural plate increased width, abnormal WT + MO1-rap1b standard conditions Fig. 6 from Tsai et al., 2007
whole organism decreased length, abnormal WT + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
Fig. 6,  Fig. S2,  Fig. S3 from Tsai et al., 2007
eye decreased amount, abnormal WT + MO1-rap1b standard conditions Fig. 6 from Tsai et al., 2007
whole organism anterior-posterior axis truncated, abnormal WT + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
whole organism increased curvature, abnormal WT + MO1-rap1b standard conditions Fig. 6,  Fig. S2 from Tsai et al., 2007
somite shape, abnormal WT + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
prechordal plate structure, abnormal WT + MO1-rap1b standard conditions Fig. S3,  text only from Tsai et al., 2007
caudal fin morphology, abnormal WT + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
convergent extension delayed, abnormal WT + MO1-rap1b standard conditions Fig. S3 from Tsai et al., 2007
caudal fin morphology, abnormal itga5tbfe1/tbfe1 + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
somite shape, abnormal itga5tbfe1/tbfe1 + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
somite border aplastic/hypoplastic, abnormal itga5tbfe1/tbfe1 + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
somite border aplastic/hypoplastic, abnormal itga5tbfe2/tbfe2 + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
somite shape, abnormal itga5tbfe2/tbfe2 + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
caudal fin morphology, abnormal itga5tbfe2/tbfe2 + MO1-rap1b standard conditions Fig. 1 with image from Lackner et al., 2013
ceratohyal cartilage increased width, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
eye decreased size, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
chondrocyte myosin II filament position, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. S4 from Bögershausen et al., 2015
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
ceratohyal cartilage chondrocyte disorganized, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. S4 from Bögershausen et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage kinked, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
chondrocyte filamentous actin position, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. S4 from Bögershausen et al., 2015
ceratohyal cartilage shortened, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 6 from Bögershausen et al., 2015
head decreased size, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
whole organism decreased length, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
MAP kinase kinase activity process quality, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 10 from Bögershausen et al., 2015
somite increased width, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 2 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b standard conditions Fig. 10 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b + MO5-kmt2d standard conditions Fig. 7 from Bögershausen et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.