ZFIN ID: ZDB-MRPHLNO-070424-1
Morpholino Name: MO1-prl
Target: prl (1)
Sequence:
5' - TAGACCCTTGAGCCATTACTAGAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-prl No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-prl
Expressed Gene Anatomy Figures
casp8 Fig. 4 from Nguyen et al., 2009
PHENOTYPE
Phenotype resulting from MO1-prl
Phenotype Figures
apoptotic DNA fragmentation increased rate, abnormal Fig. 1 from Nguyen et al., 2009
apoptotic process increased rate, abnormal Fig. 2Fig. 3 from Nguyen et al., 2009
brain apoptotic, abnormal Fig. 2Fig. 3 from Nguyen et al., 2009
immature eye apoptotic, abnormal Fig. 2Fig. 3 from Nguyen et al., 2009

Phenotype of all Fish created by or utilizing MO1-prl
Phenotype Fish Conditions Figures
apoptotic DNA fragmentation increased rate, abnormal WT + MO1-prl standard conditions Fig. 1 from Nguyen et al., 2009
immature eye apoptotic, abnormal WT + MO1-prl standard conditions Fig. 2Fig. 3 from Nguyen et al., 2009
brain apoptotic, abnormal WT + MO1-prl standard conditions Fig. 2Fig. 3 from Nguyen et al., 2009
apoptotic process increased rate, abnormal WT + MO1-prl standard conditions Fig. 2Fig. 3 from Nguyen et al., 2009
OTHER MO1-prl MORPHOLINO PAGESNo links to external sites
CITATIONS (2)