ZFIN ID: ZDB-MRPHLNO-070308-2
Morpholino Name: MO1-hmgcrb
Target: hmgcrb (1)
Sequence:
5' - TCATCATCATCACGGTCTTCAGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hmgcrb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hmgcrb
Expressed Gene Anatomy Figures
epha4a Fig. 2 with image from Mapp et al., 2011
PHENOTYPE
Phenotype resulting from MO1-hmgcrb
Phenotype of all Fish created by or utilizing MO1-hmgcrb
Genome Resources:
CITATIONS (2)