ZFIN ID: ZDB-MRPHLNO-070215-2
Morpholino Name: MO1-msx1a
Target: msx1a (1)
Previous Name: MO1-msxe

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCGAGCATCACTGTTACCACTGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-msx1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-msx1a No data available
PHENOTYPE
Phenotype resulting from MO1-msx1a
Phenotype of all Fish created by or utilizing MO1-msx1a
Phenotype Fish Conditions Figures
head apoptotic, abnormal AB + MO1-msx1a standard conditions Fig. 3 with image from Phillips et al., 2006
cranial cartilage hypoplastic, abnormal AB + MO1-msx1a standard conditions Fig. 6 with image from Phillips et al., 2006
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-msx1a standard conditions Fig. 6 with image from Phillips et al., 2006
cartilage development disrupted, abnormal AB + MO1-msx1a standard conditions Fig. 6 with image from Phillips et al., 2006
post-vent region wholly ventralized, abnormal AB + MO1-msx1a standard conditions Fig. 3 with image from Phillips et al., 2006
otic placode formation delayed, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 4 with image from Phillips et al., 2006
Rohon-Beard neuron decreased amount, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 6 with image from Phillips et al., 2006
otic vesicle decreased size, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 3 with image from Phillips et al., 2006
post-vent region wholly ventralized, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 3 with image from Phillips et al., 2006
post-vent region curved ventral, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 3 with image from Phillips et al., 2006
otic placode disorganized, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 4 with image from Phillips et al., 2006
cartilage development disrupted, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 6 with image from Phillips et al., 2006
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 6 with image from Phillips et al., 2006
trigeminal ganglion decreased size, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 4 with image from Phillips et al., 2006
head apoptotic, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 3 with image from Phillips et al., 2006
inner ear development disrupted, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 4 with image from Phillips et al., 2006
cranial cartilage hypoplastic, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 6 with image from Phillips et al., 2006
apoptotic process increased rate, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions text only from Phillips et al., 2006
otic placode decreased size, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 4 with image from Phillips et al., 2006
inner ear auditory receptor cell differentiation delayed, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions text only from Phillips et al., 2006
neural crest cell migration disrupted, abnormal AB + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions Fig. 6 with image from Phillips et al., 2006
otic placode decreased size, abnormal Df(Chr01:lef1,msxb)x8/x8 + MO1-msx1a + MO1-msx3 + MO4-msx1b standard conditions text only from Phillips et al., 2006
Genome Resources:
CITATIONS (1)