ZFIN ID: ZDB-MRPHLNO-070206-6
Morpholino Name: MO3-jag1b
Target: jag1b (1)
Sequence:
5' - AATCCTGCTACTCACTTTCACTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking morpholino
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-jag1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-jag1b
Expressed Gene Anatomy Figures
gcga Fig. S2 with image from Zecchin et al., 2007
nkx2.4b Fig. 7 from Porazzi et al., 2012
slc5a5 Fig. 7 from Porazzi et al., 2012
tg Fig. 7 from Porazzi et al., 2012
PHENOTYPE
Phenotype resulting from MO3-jag1b
Phenotype of all Fish created by or utilizing MO3-jag1b
Phenotype Fish Conditions Figures
thyroid primordium malformed, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
thyroid gland development decreased process quality, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
Meckel's cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
ceratohyal cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
hyosymplectic cartilage malformed, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
endocrine system has fewer parts of type thyroid follicle, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
palatoquadrate cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
pharyngeal endoderm nkx2.4b expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
caudal fin truncated, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
notochord morphology, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid stimulating hormone secreting cell tshba expression increased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
whole organism anterior-posterior axis decreased length, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid primordium aplastic/hypoplastic, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid primordium tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
whole organism tshba expression increased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
caudal fin kinked, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid primordium slc5a5 expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
whole organism tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
thyroid follicle tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2Fig. 3 from de Filippis et al., 2016
Genome Resources:
CITATIONS (3)