ZFIN ID: ZDB-MRPHLNO-070206-5
Morpholino Name: MO2-jag1b
Target: jag1b (1)
Sequence:
5' - ATACTGAACTCCGTCGCAGAATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-jag1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-jag1b
Expressed Gene Anatomy Figures
gcga Fig. 6 with image from Zecchin et al., 2007
prss1 Fig. 6 with image from Zecchin et al., 2007
PHENOTYPE
Phenotype resulting from MO2-jag1b
No data available

Phenotype of all Fish created by or utilizing MO2-jag1b
No data available
Genome Resources:
CITATIONS (1)