header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070121-2
Morpholino Name: MO1-ctbp1
Target: ctbp1 (1)
Sequence:
5' - TCCTTATGACGATACCTTCTCATGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocker.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ctbp1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ctbp1
Expressed Gene Anatomy Figures
aicda Fig. 2 with image from Rai et al., 2010
dhrs9 Fig. 7 from Nadauld et al., 2006
fabp2 Fig. 7 from Nadauld et al., 2006
gadd45ab Fig. 2 with image from Rai et al., 2010
mbd4 Fig. 2 with image from Rai et al., 2010
prss1 Fig. 7 from Nadauld et al., 2006
PHENOTYPE
Phenotype resulting from MO1-ctbp1
No data available

Phenotype of all Fish created by or utilizing MO1-ctbp1
Genome Resources:
CITATIONS (4)