Morpholino

MO3-hhip

ID
ZDB-MRPHLNO-061130-2
Name
MO3-hhip
Previous Names
  • MO-Zhip UTR (1)
Target
Sequence
5' - AAAGCAACTACTCGCTAAATAGGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is directed against the 5' UTR.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-hhip
No data available
Phenotype
Phenotype resulting from MO3-hhip
No data available
Phenotype of all Fish created by or utilizing MO3-hhip
Citations