Morpholino

MO2-hhip

ID
ZDB-MRPHLNO-061130-1
Name
MO2-hhip
Previous Names
  • MO-Zhip (1)
Target
Sequence
5' - AGAGCACAAATTTCAAATGCTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is directed against the translation start site.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hhip
No data available
Phenotype
Phenotype resulting from MO2-hhip
No data available
Phenotype of all Fish created by or utilizing MO2-hhip
Citations