ZFIN ID: ZDB-MRPHLNO-061002-1
Morpholino Name: MO2-stat3
Target: stat3 (1)
Sequence:
5' - CATGTTGACCCCTTAATGTGTCGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-stat3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-stat3
Expressed Gene Anatomy Figures
isl1 Fig. 6 with image from Conway, 2006
isl2a Fig. 6 with image from Conway, 2006
stat3 Fig. 1 with image from Conway, 2006
PHENOTYPE
Phenotype resulting from MO2-stat3
No data available

Phenotype of all Fish created by or utilizing MO2-stat3
Phenotype Fish Conditions Figures
macrophage acod1 expression amount, ameliorated WT + MO2-stat3 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 with image from Hall et al., 2013
blood macrophage cebpb expression increased amount, abnormal WT + MO2-stat3 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 with image from Hall et al., 2013
macrophage acod1 expression amount, ameliorated WT + MO2-stat3 + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 with image from Hall et al., 2013
OTHER MO2-stat3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)