ZFIN ID: ZDB-MRPHLNO-060811-2
Morpholino Name: MO2-dcaf7
Target: dcaf7 (1)
Previous Names: MO2-wdr68, wdr68MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATGCTTCAATCCCAGTGATCGGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-dcaf7 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-dcaf7 No data available
PHENOTYPE
Phenotype resulting from MO2-dcaf7
No data available

Phenotype of all Fish created by or utilizing MO2-dcaf7
Phenotype Fish Conditions Figures
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, abnormal WT + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development disrupted, abnormal WT + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development disrupted, abnormal WT + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, abnormal WT + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
embryonic viscerocranium morphogenesis process quality, abnormal csu9Tg + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development process quality, ameliorated csu9Tg + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, abnormal csu9Tg + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development disrupted, abnormal csu9Tg + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, ameliorated csu9Tg + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
OTHER MO2-dcaf7 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)