ZFIN ID: ZDB-MRPHLNO-060728-2
Morpholino Name: MO3-isl1
Target: isl1 (1)
Previous Name: islet1E3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAATGCAATGCCTACCTGCCATTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-isl1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-isl1
Expressed Gene Anatomy Figures
nrp1a Fig. 1 with image from Moreno et al., 2014
olig4 Fig. 3 with image from Moreno et al., 2014
runx3 Fig. 3 with image from Moreno et al., 2014
scn8aa Fig. 6 with image from Moreno et al., 2014
PHENOTYPE
Phenotype resulting from MO3-isl1
Phenotype of all Fish created by or utilizing MO3-isl1
Phenotype Fish Conditions Figures
motor neuron axon mislocalised posteriorly, abnormal AB + MO2-isl1 + MO3-isl1 standard conditions Fig. 4 with image from Hutchinson et al., 2006
VeLD increased amount, abnormal AB + MO2-isl1 + MO3-isl1 standard conditions Fig. 4 with image from Hutchinson et al., 2006
Kolmer-Agduhr neuron increased amount, abnormal AB + MO2-isl1 + MO3-isl1 standard conditions Fig. 4 with image from Hutchinson et al., 2006
secondary motor neuron decreased amount, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
MiP motor neuron axon absent, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 2 with image from Hutchinson et al., 2006
CaP motoneuron axon absent, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 2 with image from Hutchinson et al., 2006
secondary motor neuron axon decreased amount, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
secondary motor neuron axon disorganized, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
CaP motoneuron neuronal action potential process quality, abnormal WT + MO3-isl1 standard conditions Fig. 7 from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal WT + MO3-isl1 standard conditions Fig. 3 with image from Moreno et al., 2014
Rohon-Beard neuron neuronal action potential process quality, abnormal WT + MO3-isl1 standard conditions Fig. 8 from Moreno et al., 2014
CaP motoneuron membrane repolarization process quality, abnormal WT + MO3-isl1 standard conditions Fig. 7 from Moreno et al., 2014
CaP motoneuron neuron projection morphology, abnormal js12Tg + MO3-isl1 standard conditions Fig. 1 with image from Moreno et al., 2014
CaP motoneuron neuron projection displaced, abnormal js12Tg + MO3-isl1 standard conditions Fig. 1 with image from Moreno et al., 2014
CaP motoneuron neuronal action potential process quality, abnormal ml2Tg + MO3-isl1 standard conditions Fig. 4 from Moreno et al., 2014
primary motor neuron decreased amount, abnormal ml2Tg + MO3-isl1 standard conditions Fig. 2 with image from Moreno et al., 2014
CaP motoneuron neuron projection displaced, abnormal ml2Tg + MO3-isl1 standard conditions Fig. 1 with image from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal ml2Tg + MO3-isl1 standard conditions Fig. 2 with image from Moreno et al., 2014
CaP motoneuron neuron projection morphology, abnormal ml2Tg + MO3-isl1 standard conditions Fig. 1 with image from Moreno et al., 2014
Rohon-Beard neuron neuronal action potential process quality, abnormal sb4Tg + MO3-isl1 standard conditions Fig. 5 from Moreno et al., 2014
dorsal root ganglion decreased amount, abnormal sb4Tg + MO3-isl1 standard conditions Fig. 3 with image from Moreno et al., 2014
dorsal root ganglion neuron projection morphology, abnormal sb4Tg + MO3-isl1 standard conditions Fig. 3 with image from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal sb4Tg + MO3-isl1 standard conditions Fig. 2 with image from Moreno et al., 2014
spinal cord interneuron decreased amount, abnormal sb4Tg + MO3-isl1 standard conditions Fig. 2 with image from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal ym1Tg + MO3-isl1 standard conditions Fig. 6 with image from Moreno et al., 2014
secondary motor neuron absent, abnormal WT + MO1-isl2a + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
Genome Resources:
CITATIONS (8)