ZFIN ID: ZDB-MRPHLNO-060728-1
Morpholino Name: MO2-isl1
Target: isl1 (1)
Previous Name: islet1E2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTAATCTGCGTTACCTGATGTAGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-isl1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-isl1
Expressed Gene Anatomy Figures
bmp4 Fig. 8 with image from Colombo et al., 2017
ddc Fig. 6 with image from Filippi et al., 2012
isl1 Fig. S5 from Hoffmann et al., 2013
shox2 Fig. S6 from Hoffmann et al., 2013
slc6a3 Fig. 6 with image from Filippi et al., 2012
th Fig. 6 with image from Filippi et al., 2012
PHENOTYPE
Phenotype resulting from MO2-isl1
Phenotype of all Fish created by or utilizing MO2-isl1
Phenotype Fish Conditions Figures
motor neuron axon mislocalised posteriorly, abnormal AB + MO2-isl1 + MO3-isl1 standard conditions Fig. 4 with image from Hutchinson et al., 2006
VeLD increased amount, abnormal AB + MO2-isl1 + MO3-isl1 standard conditions Fig. 4 with image from Hutchinson et al., 2006
Kolmer-Agduhr neuron increased amount, abnormal AB + MO2-isl1 + MO3-isl1 standard conditions Fig. 4 with image from Hutchinson et al., 2006
heart decreased functionality, abnormal WT + MO2-isl1 standard conditions Fig. 4 from Hoffmann et al., 2013
heart contraction disrupted, abnormal WT + MO2-isl1 standard conditions Fig. 4 from Hoffmann et al., 2013
blood accumulation pericardium, abnormal WT + MO2-isl1 standard conditions Fig. 4 from Hoffmann et al., 2013
heart contraction decreased occurrence, abnormal WT + MO2-isl1 standard conditions Fig. 4 from Hoffmann et al., 2013
sinus venosus bmp4 expression absent, abnormal WT + MO2-isl1 standard conditions Fig. 8 with image from Colombo et al., 2017
regulation of heart contraction disrupted, abnormal WT + MO2-isl1 standard conditions Fig. 4 from Hoffmann et al., 2013
pericardium edematous, abnormal WT + MO2-isl1 standard conditions Fig. 4 from Hoffmann et al., 2013
secondary motor neuron axon decreased amount, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
secondary motor neuron decreased amount, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
secondary motor neuron axon disorganized, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
MiP motor neuron axon absent, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 2 with image from Hutchinson et al., 2006
CaP motoneuron axon absent, abnormal WT + MO2-isl1 + MO3-isl1 standard conditions Fig. 2 with image from Hutchinson et al., 2006
sinus venosus bmp4 expression absent, abnormal nkx2.7vu413/vu413 + MO2-isl1 standard conditions Fig. 8 with image from Colombo et al., 2017
secondary motor neuron absent, abnormal WT + MO1-isl2a + MO2-isl1 + MO3-isl1 standard conditions Fig. 3 with image from Hutchinson et al., 2006
Genome Resources:
CITATIONS (9)