ZFIN ID: ZDB-MRPHLNO-060726-2
Morpholino Name: MO2-gipc1
Target: gipc1 (1)
Previous Name: MO-ATG-2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTCTGCGTCCCAATCCAAGTGGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-start blocker, targeted to 5' UTR
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gipc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gipc1
Expressed Gene Anatomy Figures
gipc1 Fig. S2 from Chittenden et al., 2006
PHENOTYPE
Phenotype resulting from MO2-gipc1
No data available

Phenotype of all Fish created by or utilizing MO2-gipc1
Genome Resources:
CITATIONS (2)