header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060726-1
Morpholino Name: MO1-gipc1
Target: gipc1 (1)
Previous Name: MO-ATG-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGTCCCAATCCAAGTGGCATTTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-start blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gipc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gipc1
Expressed Gene Anatomy Figures
efnb2a Fig. 1 from Chittenden et al., 2006
flt4 Fig. 1 from Chittenden et al., 2006
gipc1 Fig. S2 from Chittenden et al., 2006
myl7 Fig. S3 from Chittenden et al., 2006
PHENOTYPE
Phenotype resulting from MO1-gipc1
Phenotype of all Fish created by or utilizing MO1-gipc1
Phenotype Fish Conditions Figures
MAP kinase activity increased occurrence, abnormal WT + MO1-gipc1 standard conditions Fig. 1 from Ren et al., 2010
MAP kinase activity disrupted, abnormal WT + MO1-gipc1 standard conditions Fig. 1 from Ren et al., 2010
MAP kinase activity increased occurrence, abnormal WT + MO1-gipc1 chemical treatment: pharmaceutical Fig. 1 from Ren et al., 2010
posterior cardinal vein vascular sprouts decreased amount, abnormal WT + MO1-gipc1 + MO2-gipc1 standard conditions Fig. 4 from Hermans et al., 2010
thoracic duct decreased length, abnormal y1Tg + MO1-gipc1 standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct absent, abnormal y1Tg + MO1-gipc1 standard conditions Fig. 6 from Hermans et al., 2010
intersegmental vessel absent, abnormal y1Tg + MO1-gipc1 standard conditions Fig. 7 from Ren et al., 2010
posterior cardinal vein vascular sprouts absent, abnormal y1Tg + MO1-gipc1 standard conditions Fig. 6 from Hermans et al., 2010
dorsal aorta angiogenic sprout immature, abnormal y1Tg + MO1-gipc1 standard conditions Fig. 7 from Ren et al., 2010
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO1-gipc1 standard conditions Fig. 6 from Hermans et al., 2010
dorsal longitudinal anastomotic vessel absent, abnormal y1Tg + MO1-gipc1 standard conditions Fig. 7 from Ren et al., 2010
thoracic duct absent, abnormal y1Tg + MO1-gipc1 + MO2-gipc1 standard conditions Fig. 3 from Hermans et al., 2010
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-gipc1 + MO2-gipc1 standard conditions Fig. 4 from Hermans et al., 2010
thoracic duct decreased length, abnormal y1Tg + MO1-gipc1 + MO1-nrp2a standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct absent, abnormal y1Tg + MO1-gipc1 + MO1-nrp2a standard conditions Fig. 6 from Hermans et al., 2010
posterior cardinal vein vascular sprouts absent, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct decreased length, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct absent, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
Genome Resources:
CITATIONS (3)