Morpholino
MO1-rerea
- ID
- ZDB-MRPHLNO-060718-2
- Name
- MO1-rerea
- Previous Names
-
- MO1-rere (1)
- Target
- Sequence
-
5' - TCCTTGGAGGCTGTAAACACAAATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rerea
No data available
Phenotype
Phenotype resulting from MO1-rerea
| Phenotype | Fish | Figures |
|---|---|---|
| optic stalk pax2a expression increased distribution, abnormal | AB/TL + MO1-rerea |
Fig. 7 |
Phenotype of all Fish created by or utilizing MO1-rerea
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| optic stalk pax2a expression increased distribution, abnormal | AB/TL + MO1-rerea | standard conditions |
Fig. 7 |
Citations