header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060601-6
Morpholino Name: MO1-sparc
Target: sparc (1)
Previous Name: ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCTTGAGTTTCAGCCTTCTGTCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sparc No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sparc
Expressed Gene Anatomy Figures
sparc Fig. 3 from Kang et al., 2008
PHENOTYPE
Phenotype resulting from MO1-sparc
Phenotype of all Fish created by or utilizing MO1-sparc
Genome Resources: MODB:558 (2)
CITATIONS (4)