header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060508-2
Morpholino Name: MO3-shhb
Target: shhb (1)
Previous Name: twhh-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTTCAGATGCAGCCTTACGTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a subset of MO1-shhb, targeted to the translation start region.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-shhb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-shhb
Expressed Gene Anatomy Figures
dbx1a Fig. 4 with image from Scholpp et al., 2006
dlx2a Fig. 4 with image from Scholpp et al., 2006
ptch2 Fig. 4 with image from Scholpp et al., 2006
PHENOTYPE
Phenotype resulting from MO3-shhb
Phenotype of all Fish created by or utilizing MO3-shhb
Phenotype Fish Conditions Figures
somite morphology, abnormal WIK + MO3-shhb standard conditions text only from Hammond et al., 2003
blood circulation disrupted, abnormal WIK + MO3-shhb standard conditions text only from Hammond et al., 2003
somite morphology, abnormal shhaDf(Chr07)t4/t4 + MO3-shhb standard conditions text only from Hammond et al., 2003
eye fused with eye, abnormal shhaDf(Chr07)t4/t4 + MO3-shhb standard conditions text only from Hammond et al., 2003
otolith decreased size, abnormal shhaDf(Chr07)t4/t4 + MO3-shhb standard conditions Fig. 7 with image from Hammond et al., 2003
posterior macula aplastic, abnormal shhaDf(Chr07)t4/t4 + MO3-shhb standard conditions Fig. 7 with imagetext only from Hammond et al., 2003
inner ear wholly anterioralized, abnormal shhaDf(Chr07)t4/t4 + MO3-shhb standard conditions Fig. 7 with imagetext only from Hammond et al., 2003
blood circulation disrupted, abnormal shhaDf(Chr07)t4/t4 + MO3-shhb standard conditions text only from Hammond et al., 2003
pars superior ear has extra parts of type anterior crista, abnormal shhaDf(Chr07)t4/t4 + MO3-shhb standard conditions Fig. 7 with image from Hammond et al., 2003
somite U-shaped, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
locus coeruleus neuron decreased amount, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
pericardium edematous, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
blood circulation disrupted, abnormal WT + MO3-ihhb + MO3-shha + MO3-shhb standard conditions Fig. 2 from Lam et al., 2003
OTHER MO3-shhb MORPHOLINO PAGESNo links to external sites
CITATIONS (4)